Top » Catalog » R1b » A994

$18.00

A994
[A994]

A994
hg38 Position: ChrY:8626438..8626438
Ancestral: G
Derived: C
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A994_F GCATGATTCCCTTAGAGTGAGAAC
Reverse Primer: A994_R GTGTTGTCGAGGGGGACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
1 x A244
1 x A1719
1 x A2185
1 x A240
1 x A896
1 x A848
1 x A344
1 x A16
1 x A1067
1 x A1120
1 x A938
1 x A1341
1 x A568
1 x A2200
1 x A583
1 x A1226
$306.00
Haplogroup Info
Other products
Currencies