Top » Catalog » R1b » A995

$18.00

A995
[A995]

A995
hg38 Position: ChrY:8638576..8638576
Ancestral: G
Derived: T
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A995_F CCTGCACCACTGTGATTTCC
Reverse Primer: A995_R GGAGGTAATTTCAACCAGGC
Reviews

Customers who bought this product also purchased
A988
A988
A993
A993
A987
A987
A992
A992
A986
A986
A991
A991
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A687
1 x A1343
1 x A1504
1 x A807
1 x A593
1 x A564
1 x A2233
1 x A340
1 x A1265
1 x A1191
1 x A420
1 x A735
1 x A172
1 x A508
1 x A2223
1 x A235
1 x A59
1 x A385
1 x A1290
1 x A661
1 x A2225
1 x A1242
1 x A1236
1 x A498
1 x A57
$450.00
Haplogroup Info
Other products
Currencies