Top » Catalog » R1b » A996

$18.00

A996
[A996]

A996
hg38 Position: ChrY:9922186..9922186
Ancestral: G
Derived: A
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A996_F AGACATGGTCAAGCCTGATTC
Reverse Primer: A996_R AACCTGAAGCTCTAACTAGCAGAAG
Reviews

Customers who bought this product also purchased
A989
A989
A995
A995
A988
A988
A993
A993
A987
A987
A992
A992
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies