Top » Catalog » R1b » A998

$18.00

A998
[A998]

A998
hg38 Position: ChrY:20998482..20998482
Ancestral: T
Derived: C
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A998_F CTCAATGGTGAACCACATCTG
Reverse Primer: A998_R TAGTGCTACAAACATAATCATAGGTCC
Reviews

Customers who bought this product also purchased
A987
A987
A992
A992
A986
A986
A991
A991
A997
A997
A985
A985
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies