Top » Catalog » R1b » A1064

$18.00

A1064
[A1064]

A1064
hg38 Position: ChrY:7974950..7974950
Ancestral: G
Derived: T
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1064_F TTCTCAATATCTCACAGATCTCCG
Reverse Primer: A1064_R CCACATGGAGCATTGTAACATC
Reviews

Customers who bought this product also purchased
A1071
A1071
A1063
A1063
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A763
1 x A1094
1 x A2261
1 x A752
1 x A151
1 x A2262
1 x A541
1 x A386
1 x A161
1 x A455
1 x A968
1 x A45
$234.00
Haplogroup Info
Other products
Currencies