Top » Catalog » R1b » A1065

$18.00

A1065
[A1065]

A1065
hg38 Position: ChrY:8576438..8576438
Ancestral: G
Derived: A
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1065_F CCTGACCATCTTTTGTTGACATG
Reverse Primer: A1065_R TGCTACCAGAGTTTGCCATTG
Reviews

Customers who bought this product also purchased
A1067
A1067
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1206
1 x A1715
1 x A1247
$54.00
Haplogroup Info
Other products
Currencies