Top » Catalog » R1b » A1065

$18.00

A1065
[A1065]

A1065
hg38 Position: ChrY:8576438..8576438
Ancestral: G
Derived: A
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1065_F CCTGACCATCTTTTGTTGACATG
Reverse Primer: A1065_R TGCTACCAGAGTTTGCCATTG
Reviews

Customers who bought this product also purchased
A1067
A1067
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
1 x A1126
1 x A2231
1 x A25
1 x A922
1 x A2202
1 x A766
1 x A1706
1 x A433
1 x A1001
1 x A1487
1 x A989
1 x A631
$396.00
Haplogroup Info
Other products
Currencies