Top » Catalog » R1b » A1068

$18.00

A1068
[A1068]

A1068
hg38 Position: ChrY:13047957..13047957
Ancestral: A
Derived: T
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1068_F GGGGACTGAGAAGCACTAGC
Reverse Primer: A1068_R AGCCCATTAAAGGCATTTTG
Reviews

Customers who bought this product also purchased
A1070
A1070
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2203
1 x A8
1 x A364
1 x A2209
1 x A1241
1 x A226
1 x A259
1 x A667
1 x A673
1 x A2240
1 x A1316
1 x A1310
1 x A178
1 x A1129
1 x A1330
1 x A167
1 x A1206
1 x A2251
$324.00
Haplogroup Info
Other products
Currencies