Top » Catalog » R1b » A1071

$18.00

A1071
[A1071]

A1071
hg38 Position: ChrY:21809287..21809287
Ancestral: A
Derived: G
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1071_F TGGGGCATTTACAAACCTTC
Reverse Primer: A1071_R TTGAAAAGGAGTTTACTTCCCAATAG
Reviews

Customers who bought this product also purchased
A1064
A1064
A1063
A1063
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x A1321
1 x A1544
1 x A2143
1 x A765
$90.00
Haplogroup Info
Other products
Currencies