Top » Catalog » R1b » A1133

$18.00

A1133
[A1133]

A1133
hg38 Position: ChrY:17199439..17199443
Ancestral: ins
Derived: del
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1a1
Comments: under S1121. L270.2
Forward Primer: A1133_F CTGAGTGGTATTGCACAGGG
Reverse Primer: A1133_R AAACATCCTCTCAGAATCACCC
Reviews

Customers who bought this product also purchased
BY39361
BY39361
FT43021
FT43021
FGC42469
FGC42469
A9005
A9005
BY29108
BY29108
A151
A151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies