Top » Catalog » R1b » A1140

$18.00

A1140
[A1140]

A1140
hg38 Position: ChrY:15163583..15163583
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Same position as PR2371
Forward Primer: A1140_F GTATGATTCAGAAACATCATTTCCC
Reverse Primer: A1140_R GTAGAGACAAGGTTTCGCTATGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
1 x A792
1 x A1507
1 x A1309
1 x A986
$144.00
Haplogroup Info
Other products
Currencies