Top » Catalog » R1b » A1147

$18.00

A1147
[A1147]

A1147
hg38 Position: ChrY:14071618..14071618
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC19846
Forward Primer: A1147_F TGTCACATGTTACCTCACCCTC
Reverse Primer: A1147_R CAGGGGCTTCAATATTAGAAATG
Reviews

Customers who bought this product also purchased
S659
S659
FGC33214
FGC33214
M222
M222
DF97
DF97
A259
A259
DF85
DF85
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies