Top » Catalog » R1b » A1154

$18.00

A1154
[A1154]

A1154
hg38 Position: ChrY:13551732..13551732
Ancestral: T
Derived: C
Reference: Paul Beatty (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1154v2_F CCAGTAGGTTCCAGTGGGTG
Reverse Primer: A1154v2_R CATGTTGGCCAGGACAGG
Reviews

Customers who bought this product also purchased
BY17769
BY17769
A6308
A6308
A1247
A1247
A476
A476
A430
A430
Z16433
Z16433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies