Top » Catalog » R1b » A1164

$18.00

A1164
[A1164]

A1164
hg38 Position: ChrY:12080805..12080805
Ancestral: C
Derived: T
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255. approx. Z16950
Forward Primer: A1164_F GAGTAACATCTTGGGCTCCAAC
Reverse Primer: A1164_R ATTACAGGTGTGAGCCACTGC
Reviews

Customers who bought this product also purchased
A1165
A1165
A1163
A1163
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A763
1 x A1094
1 x A2261
1 x A752
1 x A151
1 x A2262
1 x A541
1 x A386
1 x A161
1 x A455
1 x A968
1 x A45
$234.00
Haplogroup Info
Other products
Currencies