Top » Catalog » R1b » A68

$18.00

A68
[A68]

A68
hg38 Position: ChrY:6942272..6942272
Ancestral: A
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1a
Comments: Found in a R1b-DF21 person
Forward Primer: A68_F AGATAGTGCCATCGCATTCC
Reverse Primer: A68_R TAGGAGCACACCCTGTCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies