Top » Catalog » R1b » A1170

$18.00

A1170
[A1170]

A1170
hg38 Position: ChrY:8153878..8153878
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC5561
Forward Primer: A1170_F TGACTGTACAGATGTCAGTAATGGG
Reverse Primer: A1170_R GATTTCTTTCGTTCTCTACCTTGG
Reviews

Customers who bought this product also purchased
A1175
A1175
A1177
A1177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2210
1 x A974
1 x A555
1 x A1190
1 x A136
1 x A176
1 x A664
1 x A99
1 x A349
1 x A1000
$180.00
Haplogroup Info
Other products
Currencies