Top » Catalog » R1b » A70

$18.00

A70
[A70]

A70
hg38 Position: ChrY:7519881..7519881
Ancestral: C
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A70_F GCCTTTTGAGAAGCTGTTGG
Reverse Primer: A70_R TGTGTGTAGATGGGCTCTGC
Reviews

Customers who bought this product also purchased
Z18013
Z18013
A306
A306
A919
A919
A874
A874
A922
A922
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies