Top » Catalog » R1b » A70

$18.00

A70
[A70]

A70
hg38 Position: ChrY:7519881..7519881
Ancestral: C
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A70_F GCCTTTTGAGAAGCTGTTGG
Reverse Primer: A70_R TGTGTGTAGATGGGCTCTGC
Reviews

Customers who bought this product also purchased
A749
A749
A889
A889
S768
S768
S772
S772
Z18013
Z18013
A306
A306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies