Top » Catalog » R1b » A71

$18.00

A71
[A71]

A71
hg38 Position: ChrY:8535708..8535708
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A71_F TGAGCAGCAATAAGGTCAGG
Reverse Primer: A71_R GTGCATGCATCGGTAATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies