Top » Catalog » R1b » A71

$18.00

A71
[A71]

A71
hg38 Position: ChrY:8535708..8535708
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A71_F TGAGCAGCAATAAGGTCAGG
Reverse Primer: A71_R GTGCATGCATCGGTAATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
1 x A1495
1 x A927
1 x A1269
1 x A1234
1 x A2141
$396.00
Haplogroup Info
Other products
Currencies