Top » Catalog » R1b » A1197

$18.00

A1197
[A1197]

A1197
hg38 Position: ChrY:17131161..17131161
Ancestral: C
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream CTS3937
Forward Primer: A1197_F GGGGCATTGCTTTAACTGAC
Reverse Primer: A1197_R TGTAATTGAGAGCTAAAATCTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
1 x A119
1 x A700
1 x A594
1 x A1066
1 x A1715
1 x A421
1 x A890
1 x A173
1 x A292
1 x A1775
1 x A875
1 x A1740
1 x A434
1 x A639
1 x A1024
$342.00
Haplogroup Info
Other products
Currencies