Top » Catalog » R1b » A1206

$18.00

A1206
[A1206]

A1206
hg38 Position: ChrY:19848545..19848545
Ancestral: T
Derived: A
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S660
Forward Primer: A1206v2_F ATGGATCATGAAGTCAGGAGTTC
Reverse Primer: A1206v2_R TGTGTGGCTGTCTAACTTATTCCA
Reviews

Customers who bought this product also purchased
Y24597
Y24597
ZS8379
ZS8379
Z39589
Z39589
FGC23736
FGC23736
FGC4101
FGC4101
DF105
DF105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A100
1 x A2075
1 x A165
1 x A967
1 x A517
1 x A1096
1 x A976
1 x A360
1 x A495
1 x A338
1 x A725
1 x A977
1 x A596
1 x A314
1 x A40
1 x A174
1 x A471
1 x A2148
$324.00
Haplogroup Info
Other products
Currencies