Top » Catalog » R1b » A78

$18.00

A78
[A78]

A78
hg38 Position: ChrY:12800411..12800411
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A78_F CCTAATCGAGCTGAAAACTAGTGG
Reverse Primer: A78_R ACACCACCCTCCAGGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
$234.00
Haplogroup Info
Other products
Currencies