Top » Catalog » R1b » A81

$18.00

A81
[A81]

A81
hg38 Position: ChrY:8718573..8718573
Ancestral: A
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A81_F GCCCAATACTCTAACCACACG
Reverse Primer: A81_R CATATCATGAGGGGGCAATC
Reviews

Customers who bought this product also purchased
A89
A89
A88
A88
A90
A90
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies