Top » Catalog » R1b » A88

$18.00

A88
[A88]

A88
hg38 Position: ChrY:16273027..16273027
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A88_F GAAGGATGGAAGAAGCTTGG
Reverse Primer: A88_R GCAGGATGGGCATGTAGG
Reviews

Customers who bought this product also purchased
L21
L21
A12017
A12017
DF13
DF13
L513
L513
A2295
A2295
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies