Top » Catalog » R1b » A88

$18.00

A88
[A88]

A88
hg38 Position: ChrY:16273027..16273027
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A88_F GAAGGATGGAAGAAGCTTGG
Reverse Primer: A88_R GCAGGATGGGCATGTAGG
Reviews

Customers who bought this product also purchased
L21
L21
Z255
Z255
DF49
DF49
FGC11134
FGC11134
A12017
A12017
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies