Top » Catalog » R1b » A89

$18.00

A89
[A89]

A89
hg38 Position: ChrY:16460286..16460286
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A89_F ACTGGCCTGGGGAACATAG
Reverse Primer: A89_R CCTCTTGAAGCATTCCATGAC
Reviews

Customers who bought this product also purchased
S1115
S1115
A2220
A2220
Z16258
Z16258
A156
A156
A761
A761
A1333
A1333
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies