Top » Catalog » R1b » A90

$18.00

A90
[A90]

A90
hg38 Position: ChrY:20414685..20414685
Ancestral: C
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A90_F TCTCATACAATTAATTACAATACATACTCTGTATG
Reverse Primer: A90_R AGAGTGGATGGCTAGTGGCTG
Reviews

Customers who bought this product also purchased
A1333
A1333
CTS4466
CTS4466
ZS4590
ZS4590
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Z16259
Z16259
S1121
S1121
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
1 x A48
1 x A120
1 x A14
1 x A47
1 x A119
1 x A95
1 x A155
1 x A94
1 x A93
1 x A136
1 x A101
1 x A92
1 x A135
1 x A43
1 x A60
1 x A3
1 x A133
1 x A162
1 x A151
1 x A81
1 x A146
1 x A132
1 x A167
1 x A33
1 x A6
$468.00
Haplogroup Info
Other products
Currencies