Top » Catalog » R1b » A1226

$18.00

A1226
[A1226]

A1226
hg38 Position: ChrY:8509152..8509152
Ancestral: G
Derived: A
Reference: Geoffrey Grant (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Downstream DF88
Forward Primer: A1226_F CTGGTGGCTTTACATTCCAG
Reverse Primer: A1226_R AGAGAGGCATGTTCCACAAC
Reviews

Customers who bought this product also purchased
A1227
A1227
A578
A578
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies