Top » Catalog » R1b » A1227

$18.00

A1227
[A1227]

A1227
hg38 Position: ChrY:8887867..8887867
Ancestral: G
Derived: C
Reference: Geoffrey Grant (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Downstream DF88
Forward Primer: A1227_F GGAGTAAGACAACTTGTATAGGTTTAACA
Reverse Primer: A1227_R TTTACAACCAATCTATGAAAGGGC
Reviews

Customers who bought this product also purchased
A1226
A1226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies