Top » Catalog » R1b » A1229

$18.00

A1229
[A1229]

A1229
hg38 Position: ChrY:13023256..13023256
Ancestral: T
Derived: C
Reference: Geoffrey Grant (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Downstream DF88
Forward Primer: A1229_F TGCTTTTGGTTTCACTGAGG
Reverse Primer: A1229_R CTCCCCTCAAGAGAGCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies