Top » Catalog » R1b » A1223

$18.00

A1223
[A1223]

A1223
hg38 Position: ChrY:13502852..13502852
Ancestral: A
Derived: G
Reference: Geoffrey Grant (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Downstream DF88
Forward Primer: A1223_F CCCACATGACCGTTCACTAC
Reverse Primer: A1223_R TCACAAGCATGAAGGCTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A997
$36.00
Haplogroup Info
Other products
Currencies