Top » Catalog » R1b » A91

$18.00

A91
[A91]

A91
hg38 Position: ChrY:2950580..2950580
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c2 (not listed)
Comments: Found in a R1b-DF63 person
Forward Primer: A91_F GGATTAAGCCACCACACCAG
Reverse Primer: A91_R ATAAGGGCTGACCACCAATC
Reviews

Customers who bought this product also purchased
BY711
BY711
DF21
DF21
DF49
DF49
Z39589
Z39589
A7811
A7811
Z16246
Z16246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies