Top » Catalog » R1b » A91

$18.00

A91
[A91]

A91
hg38 Position: ChrY:2950580..2950580
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c2 (not listed)
Comments: Found in a R1b-DF63 person
Forward Primer: A91_F GGATTAAGCCACCACACCAG
Reverse Primer: A91_R ATAAGGGCTGACCACCAATC
Reviews

Customers who bought this product also purchased
BY20329
BY20329
A5846
A5846
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
BY711
BY711
DF21
DF21
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies