Top » Catalog » R1b » A1230

$18.00

A1230
[A1230]

A1230
hg38 Position: ChrY:9127876..9127876
Ancestral: T
Derived: G
Reference: Arthur Staples (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1230_F CAAGGAAAAGAGGTCTTAACAAAGG
Reverse Primer: A1230_R ATCTCCTAGCCTCAGTGATAATGC
Reviews

Customers who bought this product also purchased
A100
A100
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2127
$18.00
Haplogroup Info
Other products
Currencies