Top » Catalog » R1b » A92

$18.00

A92
[A92]

A92
hg38 Position: ChrY:8471148..8471148
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c2 (not listed)
Comments: Found in a R1b-DF63 person
Forward Primer: A92_F TTTTGCCCAGATCCTGAATG
Reverse Primer: A92_R CCACCTCTCTGGTAAAATGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A447
1 x A250
1 x A441
1 x A671
1 x A579
1 x A1169
1 x A760
1 x A747
1 x A1491
1 x A1712
1 x A109
1 x A1224
1 x A162
1 x A983
$252.00
Haplogroup Info
Other products
Currencies