Top » Catalog » R1b » A93

$18.00

A93
[A93]

A93
hg38 Position: ChrY:12919299..12919299
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c2 (not listed)
Comments: Found in a R1b-DF63 person
Forward Primer: A93_F CTACAGGCCTGGTTGGATTC
Reverse Primer: A93_R GCATCTGGCCACAAAATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies