Top » Catalog » R1b » A1234

$19.00

A1234
[A1234]

A1234
hg38 Position: ChrY:12863927..12863927
Ancestral: C
Derived: T
Reference: Ron Dryden (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: .
Forward Primer: A1234_F GTTGTCCACAAAGTATCCTACGC
Reverse Primer: A1234_R CTATCCAGCTTCTCCAACCTCTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A765
A765
A753
A753
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies