Top » Catalog » R1b » A1241

$18.00

A1241
[A1241]

A1241
hg38 Position: ChrY:7030008..7030008
Ancestral: T
Derived: C
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Downstream Z255
Forward Primer: A1241_F TATTCCTTCCCTGCACCTTG
Reverse Primer: A1241_R CTCCGCCTTAGTTGGAAAAG
Reviews

Customers who bought this product also purchased
Z16437
Z16437
Z16950
Z16950
Z16434
Z16434
Z16431
Z16431
Z16433
Z16433
A1236
A1236
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies