Top » Catalog » R1b » A1241

$18.00

A1241
[A1241]

A1241
hg38 Position: ChrY:7030008..7030008
Ancestral: T
Derived: C
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Downstream Z255
Forward Primer: A1241_F TATTCCTTCCCTGCACCTTG
Reverse Primer: A1241_R CTCCGCCTTAGTTGGAAAAG
Reviews

Customers who bought this product also purchased
R1b-Z255 Panel
R1b-Z255 Panel
L159.2
L159.2
Z255
Z255
S23035
S23035
Z16437
Z16437
Z16950
Z16950
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A892
$18.00
Haplogroup Info
Other products
Currencies