Top » Catalog » R1b » A1243

$18.00

A1243
[A1243]

A1243
hg38 Position: ChrY:13197506..13197506
Ancestral: A
Derived: G
Reference: Andrew Booth (2014)
ISOGG Haplogroup: R1b1a1a2a1a1a3
Comments: Below U106 > FGC3862
Forward Primer: A1243_F GCCTATCAGAATCCCTCCAC
Reverse Primer: A1243_R TTGAGCCTTAAATCCTTTGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A559
1 x A466
1 x A600
1 x A817
1 x A770
1 x A2118
1 x A1279
1 x A442
1 x A903
1 x A2133
1 x A90
1 x A949
1 x A1318
1 x A1770
1 x A935
1 x A159
1 x A312
1 x A2269
1 x A157
$342.00
Haplogroup Info
Other products
Currencies