Top » Catalog » R1b » A1243

$18.00

A1243
[A1243]

A1243
hg38 Position: ChrY:13197506..13197506
Ancestral: A
Derived: G
Reference: Andrew Booth (2014)
ISOGG Haplogroup: R1b1a1a2a1a1a3
Comments: Below U106 > FGC3862
Forward Primer: A1243_F GCCTATCAGAATCCCTCCAC
Reverse Primer: A1243_R TTGAGCCTTAAATCCTTTGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A426
1 x A720
$36.00
Haplogroup Info
Other products
Currencies