Top » Catalog » R1b » A95

$18.00

A95
[A95]

A95
hg38 Position: ChrY:17404346..17404346
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c2 (not listed)
Comments: Found in a R1b-DF63 person
Forward Primer: A95_F CAGAGAATAACCTGTCTGCTAGTAATCAG
Reverse Primer: A95_R GCAGTCCTGATGGTTAGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
1 x A48
1 x A120
1 x A14
1 x A47
1 x A119
1 x A95
1 x A155
1 x A94
$162.00
Haplogroup Info
Other products
Currencies