Top » Catalog » R1b » A1256

$18.00

A1256
[A1256]

A1256
hg38 Position: ChrY:14346857..14346857
Ancestral: T
Derived: A
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1256_F ATATGGGAGGGTGTGCAGAG
Reverse Primer: A1256_R GTTGATTGTCTGCCTTCACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A887
1 x A800
1 x A121
$54.00
Haplogroup Info
Other products
Currencies