Top » Catalog » R1b » A1257

$18.00

A1257
[A1257]

A1257
hg38 Position: ChrY:14477191..14477191
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1257_F AGCTCAGGAGAAAACCCAGTC
Reverse Primer: A1257_R CCAGCTCTCAGGTTCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies