Top » Catalog » R1b » A1258

$18.00

A1258
[A1258]

A1258
hg38 Position: ChrY:15703140..15703140
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1258_F CCCTGCCTCAAATCTGGAC
Reverse Primer: A1258_R CCTCTGAGCCAGCTACTTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A197
1 x A2116
1 x A363
1 x A2216
1 x A54
1 x A101
1 x A2150
1 x A1030
1 x A1071
$162.00
Haplogroup Info
Other products
Currencies