Top » Catalog » R1b » A1259

$18.00

A1259
[A1259]

A1259
hg38 Position: ChrY:17382370..17382370
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1259_F CATAATGACATTTATGTCAACAGAGAAG
Reverse Primer: A1259_R TCCATATCTATAGTCATAAACATACCCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
1 x A1126
1 x A2231
1 x A25
1 x A922
1 x A2202
1 x A766
1 x A1706
$306.00
Haplogroup Info
Other products
Currencies