Top » Catalog » R1b » A1259

$18.00

A1259
[A1259]

A1259
hg38 Position: ChrY:17382370..17382370
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1259_F CATAATGACATTTATGTCAACAGAGAAG
Reverse Primer: A1259_R TCCATATCTATAGTCATAAACATACCCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies