Top » Catalog » R1b » A1260

$18.00

A1260
[A1260]

A1260
hg38 Position: ChrY:19994820..19994820
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1260_F AAATGGGAGTGGAATTGCTG
Reverse Primer: A1260_R ATTACCGAAAGGGGCAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies