Top » Catalog » R1b » A1292

$18.00

A1292
[A1292]

A1292
hg38 Position: ChrY:8799085..8799085
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1292v2_F CATCCAAATAGAGAGGTAAATCGG
Reverse Primer: A1292v2_R CAAGGAGACCATAACCACCC
Reviews

Customers who bought this product also purchased
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1291
A1291
A1301
A1301
DNA Sample Kit
DNA Sample Kit
A1308
A1308
A1290
A1290
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies