Top » Catalog » R1b » A1297

$18.00

A1297
[A1297]

A1297
hg38 Position: ChrY:12287390..12287390
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1297_F ACTCGAGGACGGGATGTTTC
Reverse Primer: A1297_R CCAGCTCCTCCTAGCCAAAC
Reviews

Customers who bought this product also purchased
A1307
A1307
A1289
A1289
A1298
A1298
A1304
A1304
A1149
A1149
A1293
A1293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies