Top » Catalog » R1b » A1298

$18.00

A1298
[A1298]

A1298
hg38 Position: ChrY:15660443..15660443
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1298v2_F GCACAGTGTCTGGTGTTAACAAC
Reverse Primer: A1298v2_R AAACACTGTTGCTTTTGTGCA
Reviews

Customers who bought this product also purchased
MC14
MC14
CTS3386
CTS3386
FGC43417
FGC43417
YFS444718
YFS444718
Z39589
Z39589
A117
A117
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A139
1 x A1370
1 x A2072
1 x A809
1 x A2217
1 x A2142
$108.00
Haplogroup Info
Other products
Currencies